Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e3f0
Genome
Xanthomonas campestris - NC_007086.1
TF
HrpX [UniProtKB:A0A0H2X9M1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCGCACATGAAAATAAAGGTTCGC + [3591808, 3591832] 19810809 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details GUS reporter gene assay (ECO:0005641) - 1128

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... XC_2995 XC_2994 XC_2993 XC_2996 XC_2997
Gene Locus tag Description
XC_2995 XC_2995 hypothetical protein
XC_2994 XC_2994 hypothetical protein
XC_2993 XC_2993 IS1479 transposase
XC_2996 XC_2996 hypothetical protein
XC_2997 XC_2997 hypothetical protein