Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e510
Genome
Pectobacterium carotovorum - NC_018525.1
TF
RdgB [UniProtKB:Q47588, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GTTTTCTAATTCACTTTAAAATCGTT + [1809511, 1809536] 18689515 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 1134

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PCC21_015920 PCC21_015930
Gene Locus tag Description
PCC21_015920 PCC21_015920 hypothetical protein
PCC21_015930 PCC21_015930 hypothetical protein