Curation Information

Publication
Iron-responsive regulation of the Helicobacter pylori iron-cofactored superoxide dismutase SodB is mediated by Fur.;Ernst FD, Homuth G, Stoof J, Mäder U, Waidner B, Kuipers EJ, Kist M, Kusters JG, Bereswill S, van Vliet AH;Journal of bacteriology 2005 Jun; 187(11):3687-92 [15901691]
TF
Fur [Q1CU85, view regulon]
Reported TF sp.
Helicobacter pylori 26695
Reported site sp.
Helicobacter pylori 26695
Created by
Joe Sparenberg
Curation notes
-

Experimental Process

2D PAGE determined that apo-Fur represses sodB and the results were confirmed by MALDI-TOF. EMSA showed that Fur directly binds to sodB with low affinity. DNase I footprinting showed the sequence of the binding site.

Transcription Factor Binding Sites


AAGAAAAGATTTACCAAAAAGTATTAAAAAATGATTACAATAA
AAGAAAAGATTTACCAAAAAGTATTAAAAAATGATTACAATAA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type