A computational search was performed using 20 known LexA sites to identify potential sites. EMSA was performed to show binding.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
AACTGGACGTTTGTACAGCA | rmuC, |
|
repressor | dimer | |
GACTGTATAAAACCACAGCC | polB, |
|
repressor | dimer |