rmlBDAC operon transcription start was determined by primer extension analysis. A putative RhlR binding site resembling a las box was identified by visual inspection of the rmlBDAC promoter. rmlBDAC-lacZ fusion assays using rhlR mutant strain showed the expression of the rmlBDAC operon in early stationary phase is dependent on RhlR. Deletion of the putative binding site resulted in lower expression levels in lacZ reporter assays. Site-directed mutagenesis of the RhlR binding site completely abolished the induction of the lacZ promoter fusion by RhlR.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| ACCTACCAGATCTGGGGTTG | rmlB, rmlD, rmlA, rmlC, |
|
activator | not specified |