Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005110
Genome
Escherichia coli - NC_000913.2
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TACTGTACGTATCGACAGTT + [1808201, 1808220] 10760155 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Hydroxyl-radical footprinting (ECO:0005643) - Experimental technique details Northern blot (ECO:0005653) - Experimental technique details PSSM site search (ECO:0005659) - 287

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ydjM yniC
Gene Locus tag Description
ydjM b1728 inner membrane protein regulated by LexA
yniC b1727 2-deoxyglucose-6-P phosphatase