LacR regulon and binding site collection in Streptococcus intermedius JTH08

LacR - UniProtKB: T1ZD52 regulon and binding site collection of Streptococcus intermedius JTH08

Sites are listed as curated.

TGTTTGACTTTGTTTTGTTT
TGCTTTATTTTGTTGTTTTT

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

TGTTTGACTTTGTTTTGTTT
TGCTTTATTTTGTTGTTTTT

Motif structure	Direct repeat
GC-content	22.50%
Regulatory mode	Activation	Repression	Dual	Not specified
Regulatory mode	0%	0%	0%	100%
TF conformation	Monomer	Dimer	Tetramer	Other	Not specified
TF conformation	0%	0%	0%	0%	100%
Binding site type	Motif-associated	Variable-motif-associated	Non-motif-associated
Binding site type	2	0	0

For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

Genome	TF	TF conformation	Site sequence	Site location	Experimental techniques	Gene regulation	Curations	PMIDs
NC_018073.1	T1ZD52	not specified	TGTTTGACTTTGTTTTGTTT	+[1323781:1323800]	Experimental technique details DNA affinity purification (ECO:0005629) DNA affinity purification - ECO:0005629 In DNA affinity purification, DNA from promoter regions thought to be bound by the protein is labelled (e.g. biotinylated) and bound to beads (or some type of matrix). The protein is then left to interact with DNA and eventually eluted. Bound protein will remain attached to beads. This can be detected through gel electophoresis. The protein can then be sequenced by mass-spectrometry. The techinque can be used to demonstrate binding of a purified protein, or to purify the binding protein from crude extract or a mix of proteins. - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge	lacR (SCIM_1151) , lacD (SCIM_1152)	930	23798532
NC_018073.1	T1ZD52	not specified	TGCTTTATTTTGTTGTTTTT	+[1321750:1321769]	Experimental technique details DNA affinity purification (ECO:0005629) DNA affinity purification - ECO:0005629 In DNA affinity purification, DNA from promoter regions thought to be bound by the protein is labelled (e.g. biotinylated) and bound to beads (or some type of matrix). The protein is then left to interact with DNA and eventually eluted. Bound protein will remain attached to beads. This can be detected through gel electophoresis. The protein can then be sequenced by mass-spectrometry. The techinque can be used to demonstrate binding of a purified protein, or to purify the binding protein from crude extract or a mix of proteins. - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge	SCIM_1148 , SCIM_1147 , SCIM_1146 , lacC (SCIM_1145) , SCIM_1144 , SCIM_1149 , lacB (SCIM_1150)	930	23798532

All binding sites in split view are combined and a sequence logo is generated. Note that it may contain binding site sequences from different transcription factors and different species. To see individiual sequence logos and curation details go to split view.

Sites are listed as curated.

TGTTTGACTTTGTTTTGTTT
TGCTTTATTTTGTTGTTTTT

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

TGTTTGACTTTGTTTTGTTT
TGCTTTATTTTGTTGTTTTT

To generate the weblogo, aligned binding sites are used.

	Download data in FASTA format.
	Download data in TSV (tab-separated-value) format. For each binding site, all sources of evidence (i.e. experimental techniques and publication information) are combined into one record.
	Download raw data in TSV format. All reported sites are exported individually.
	Download data in Attribute-Relation File Format (ARFF).
	Download Position-Specific-Frequency-Matrix of the motif in TRANSFAC format.
	Download Position-Specific-Frequency-Matrix of the motif in JASPAR format.
	Download Position-Specific-Frequency-Matrix of the motif in raw FASTA format. The matrix consists of four columns in the order A C G T.