LasR - UniProtKB: P54292 regulon and binding site collection of Pseudomonas aeruginosa PAO1


Sites are listed as curated.

TCCTGTGAAATCTGGCAGTT
TCCTGTGAAATCTGGCAGTT
CCTGTGAATTCCGGTAGTT
ACCTACCAGATCTGGGGTTG
TCCTGCATGAATTGGTAGGC
TCCTGTGAAATCTGGCAGTT

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

TCCTGTGAAATCTGGCAGTT
TCCTGTGAAATCTGGCAGTT
ACCTGTGAATTCCGGTAGTT
ACCTACCAGATCTGGGGTTG
GCCTACCAATTCATGCAGGA
TCCTGTGAAATCTGGCAGTT

For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

    Genome TF TF conformation Site sequence Site location Experimental techniques Gene regulation Curations PMIDs
    NC_002516.2 P54292 dimer TCCTGTGAAATCTGGCAGTT -[3893268:3893287] Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Visual sequence inspection (nan) rhlA (PA3479) , rhlB (PA3478) , rhlR (PA3477) , PA3480 , PA3481 , metG (PA3482) , PA3483 , PA3484 , PA3485
    ... ... rhlA rhlB rhlR PA3480 PA3481 metG PA3483 PA3484 PA3485
    418 14526008
    NC_002516.2 P54292 dimer TCCTGTGAAATCTGGCAGTT -[3893268:3893287] Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Visual sequence inspection (nan) rhlA (PA3479) , rhlB (PA3478) , rhlR (PA3477) , PA3480 , PA3481 , metG (PA3482) , PA3483 , PA3484 , PA3485
    ... ... rhlA rhlB rhlR PA3480 PA3481 metG PA3483 PA3484 PA3485
    419 14526008
    NC_002516.2 P54292 not specified CCTGTGAATTCCGGTAGTT -[1224390:1224408] Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details RNAse protection (ECO:0000288) PA1131 , rhlC (PA1130) , PA1132
    ... ... PA1131 rhlC PA1132
    734 11359576
    NC_002516.2 P54292 not specified ACCTACCAGATCTGGGGTTG +[5810145:5810164] Experimental technique details Beta-gal reporter assay - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) rmlB (PA5161) , rmlD (PA5162) , rmlA (PA5163) , rmlC (PA5164) , PA5165 , PA5166
    ... ... rmlB rmlD rmlA rmlC PA5165 PA5166
    780 22262098
    NC_002516.2 P54292 not specified TCCTGCATGAATTGGTAGGC -[2905653:2905672] Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) lecA (PA2570)
    ... ... lecA
    783 11053384
    NC_002516.2 P54292 not specified TCCTGTGAAATCTGGCAGTT -[3893268:3893287] Experimental technique details Beta-gal reporter assay - Experimental technique details Site directed mutagenesis (ECO:0005667) rhlA (PA3479) , rhlB (PA3478) , rhlR (PA3477)
    ... ... rhlA rhlB rhlR
    823 24935161

    LasR - UniProtKB: P25084 regulon and binding site collection of Pseudomonas aeruginosa PAO1


    Sites are listed as curated.

    ATCTATCTCATTTGCTAGTT
    CTGTGCCCACGACCAG
    CTGCGCGCTTGACAGC
    CTGGCATAACAGATAG
    CTAGCAAATGAGATAG
    CTAAGATAGCTATCAC
    GCGTCAGATTTCCTCG
    GAAAGGGATAGGCTAG
    CTTCGCAACCTCCCAG
    CTTACAAATCTGTTAG
    CTATCACTTGGAGTAG
    CCTGCTTTTCTGCTAG
    CTATCAATTGTATTAG
    CTACCAGAACTGGTAG
    CTGGCATAACAGATAG
    TGAGCAGTTCAGATAG
    CTGGCAGAACTGACAG
    CTACCCACCCTGTTCG
    CACCCTGTTCGTATCT
    CTCGATCTTCTGATAG
    TTTTCAGTTGGACTCG
    TAGCGAAAACATATCG
    CCATCTGACATGTAGG
    CCTGGAGACCAGGCTG
    CAATCAGAAATGTCCC
    CTAACAAAAGACATAG
    CCGTCAGTATTGTTAG
    CTGTGAAATCTGGCAG
    CTACCAGATCTGGCAG
    CTGTCGGTTCGCATAG
    CTGCCCATAATCCCCG
    CTATCAGTTCTGTAGT
    CTGTGAGATTTGGGAG
    CTACCTGTTTTGGTAG
    CTATCAGAATGAATAG
    CTATCCATTCTGATGG
    CCGACAAATCTGTGAC
    CTGGCCGATGGGCGCG
    CTATGCGTCCGGACAG
    CTATCCGTTCTGTCCC
    GTACCTGAACTGCCAG
    CTATCTGAAATGCGAG
    CTATCAATTGTATTAG
    CTAGCAAATGAGATAG
    CCATCTGACATGTAGG
    CCTGGAGACCAGGCTG
    CAATCAGAAATGTCCC
    GCGTCAGATTTCCTCG
    CTAAGATAGCTATCAC
    TTTTCAGTTGGACTCG
    TAGCGAAAACATATCG
    TAACTAGCAAATGAGATAGATT
    TCACATATCTGATAGCCTG
    ACCTACCAGAACTGGTAGTT
    ACCTGCCCGGAAGGGCAGGT
    CACTGCCAGATCTGGCAGTT
    ACCTACCAGATCTTGTAGTT
    ACCTGCCAGTTCTGGCAGGT
    ACCTGCTTTTCTGCTAGCT
    CCCTACCAGATCTGGCAGG

    Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

    AATCTATCTCATTTGCTAGTTAT
    GCCCTGTGCCCACGACCAGTTCG
    GACGCTGTCAAGCGCGCAGCCTT
    ACCCTATCTGTTATGCCAGCACC
    AATCTATCTCATTTGCTAGTTAT
    TTTGTGATAGCTATCTTAGCATT
    GCGGCGTCAGATTTCCTCGTCTA
    CGGGAAAGGGATAGGCTAGCGGC
    CTCCTGGGAGGTTGCGAAGCCGC
    AACCTAACAGATTTGTAAGTTGC
    CAGCTACTCCAAGTGATAGCTAG
    CCACCTGCTTTTCTGCTAGCTAT
    GAGCTAATACAATTGATAGGGTG
    CACCTACCAGAACTGGTAGTTCT
    ACCCTATCTGTTATGCCAGCACC
    AACCTATCTGAACTGCTCAGGAG
    GACCTGTCAGTTCTGCCAGGTGG
    ATACGAACAGGGTGGGTAGCGGG
    ACCCACCCTGTTCGTATCTCCGC
    CAACTCGATCTTCTGATAGGGTC
    AAACGAGTCCAACTGAAAAGGAC
    TTTCGATATGTTTTCGCTACGCC
    CTTCCATCTGACATGTAGGAATC
    GTCCAGCCTGGTCTCCAGGCAGT
    GATGGGACATTTCTGATTGAACG
    AACCTATGTCTTTTGTTAGCGTA
    TTACCGTCAGTATTGTTAGTTGT
    TAACTGCCAGATTTCACAGGACG
    CGCCTGCCAGATCTGGTAGGCGG
    CCTCTGTCGGTTCGCATAGGTCG
    TTGCTGCCCATAATCCCCGGACA
    CCCACTACAGAACTGATAGTAGA
    CGCCTCCCAAATCTCACAGTTCG
    TAACTACCTGTTTTGGTAGGGTT
    TTCCTATCAGAATGAATAGCTAT
    AACCCATCAGAATGGATAGGGGT
    GCTGTCACAGATTTGTCGGAAAT
    TACCGCGCCCATCGGCCAGCCTG
    GACCTGTCCGGACGCATAGCAGG
    CGCGGGACAGAACGGATAGTTGA
    TTAGTACCTGAACTGCCAGCTTG
    CAGCTATCTGAAATGCGAGCGAT
    GAGCTAATACAATTGATAGGGTG
    AATCTATCTCATTTGCTAGTTAT
    CTTCCATCTGACATGTAGGAATC
    GTCCAGCCTGGTCTCCAGGCAGT
    GATGGGACATTTCTGATTGAACG
    GCGGCGTCAGATTTCCTCGTCTA
    TTTGTGATAGCTATCTTAGCATT
    AAACGAGTCCAACTGAAAAGGAC
    TTTCGATATGTTTTCGCTACGCC
    AATCTATCTCATTTGCTAGTTAT
    GCGGTCACATATCTGATAGCCTG
    GAACTACCAGTTCTGGTAGGTGC
    TACCTGCCCGGAAGGGCAGGTTG
    CAACTGCCAGATCTGGCAGTGGC
    CAACTACAAGATCTGGTAGGTGC
    AACCTGCCAGAACTGGCAGGTAG
    CCACCTGCTTTTCTGCTAGCTAT
    AACCTGCCAGATCTGGTAGGGCG

    For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

      Genome TF TF conformation Site sequence Site location Experimental techniques Gene regulation Curations PMIDs
      NC_002516.2 P25084 dimer ATCTATCTCATTTGCTAGTT +[1559178:1559197] Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) rsaL (PA1431) , lasR (PA1430) , lasI (PA1432) , PA1433 , PA1434
      ... ... rsaL lasR lasI PA1433 PA1434
      475 15505212
      NC_002516.2 P25084 not specified CTGTGCCCACGACCAG -[3891014:3891029] Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) rhlR (PA3477) , rhlA (PA3479) , rhlB (PA3478)
      ... ... rhlR rhlA rhlB
      415 21719541
      NC_002516.2 P25084 not specified CTGCGCGCTTGACAGC -[3890706:3890721] Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) rhlR (PA3477) , rhlA (PA3479) , rhlB (PA3478)
      ... ... rhlR rhlA rhlB
      415 21719541
      NC_002516.2 P25084 not specified CTGGCATAACAGATAG -[3890752:3890767] Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) rhlR (PA3477) , rhlA (PA3479) , rhlB (PA3478)
      ... ... rhlR rhlA rhlB
      415 21719541
      NC_002516.2 P25084 dimer CTAGCAAATGAGATAG -[1559180:1559195] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) lasI (PA1432) , rsaL (PA1431) , PA1434 , PA1433 , lasR (PA1430)
      ... ... lasI rsaL PA1434 PA1433 lasR
      421 19682264
      NC_002516.2 P25084 dimer CTAAGATAGCTATCAC +[2453504:2453519] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) pslL (PA2242) , pslK (PA2241) , pslJ (PA2240) , pslI (PA2239) , pslH (PA2238) , pslG (PA2237) , pslF (PA2236) , pslE (PA2235) , pslD (PA2234) , pslC (PA2233) , pslB (PA2232) , pslA (PA2231) , PA2229 , PA2230
      ... ... pslL pslK pslJ pslI pslH pslG pslF pslE pslD pslC pslB pslA PA2229 PA2230
      421 19682264
      NC_002516.2 P25084 dimer GCGTCAGATTTCCTCG +[2453397:2453412] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) pslL (PA2242) , pslK (PA2241) , pslJ (PA2240) , pslI (PA2239) , pslH (PA2238) , pslG (PA2237) , pslF (PA2236) , pslE (PA2235) , pslD (PA2234) , pslC (PA2233) , pslB (PA2232) , pslA (PA2231) , PA2229 , PA2230
      ... ... pslL pslK pslJ pslI pslH pslG pslF pslE pslD pslC pslB pslA PA2229 PA2230
      421 19682264
      NC_002516.2 P25084 dimer GAAAGGGATAGGCTAG +[5366212:5366227] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) cueR (PA4778) , PA4773 , PA4774 , PA4775 , pmrA (PA4776) , pmrB (PA4777)
      ... ... cueR PA4773 PA4774 PA4775 pmrA pmrB
      421 19682264
      NC_002516.2 P25084 dimer CTTCGCAACCTCCCAG +[5366231:5366246] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) cueR (PA4778) , PA4773 , PA4774 , PA4775 , pmrA (PA4776) , pmrB (PA4777)
      ... ... cueR PA4773 PA4774 PA4775 pmrA pmrB
      421 19682264
      NC_002516.2 P25084 dimer CTTACAAATCTGTTAG -[3730298:3730313] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) PA3326 , PA3331 , PA3330 , PA3329 , PA3328 , PA3327 , PA3340 , plpD (PA3339) , PA3338 , rfaD (PA3337) , PA3336 , PA3335 , PA3334 , fabH2 (PA3333) , PA3332
      ... ... PA3326 PA3331 PA3330 PA3329 PA3328 PA3327 PA3340 plpD PA3338 rfaD PA3336 PA3335 PA3334 fabH2 PA3332
      421 19682264
      NC_002516.2 P25084 dimer CTATCACTTGGAGTAG -[5247575:5247590] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) PA4677 , PA4679 , rimI (PA4678) , PA4675 , PA4676
      ... ... PA4677 PA4679 rimI PA4675 PA4676
      421 19682264
      NC_002516.2 P25084 dimer CCTGCTTTTCTGCTAG -[4170719:4170734] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) lasB (PA3724) , PA3732 , PA3731 , PA3730 , PA3729 , PA3728 , PA3727 , PA3726 , recJ (PA3725)
      ... ... lasB PA3732 PA3731 PA3730 PA3729 PA3728 PA3727 PA3726 recJ
      421 19682264
      NC_002516.2 P25084 dimer CTATCAATTGTATTAG -[2545013:2545028] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) ambE (PA2302) , ambD (PA2303) , ambC (PA2304) , ambB (PA2305) , PA2310 , PA2309 , PA2308 , PA2307 , ambA (PA2306) , PA2301
      ... ... ambE ambD ambC ambB PA2310 PA2309 PA2308 PA2307 ambA PA2301
      421 19682264
      NC_002516.2 P25084 dimer CTACCAGAACTGGTAG -[2934484:2934499] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) PA2592 , PA2591 , PA2588 , PA2589 , PA2590
      ... ... PA2592 PA2591 PA2588 PA2589 PA2590
      421 19682264
      NC_002516.2 P25084 dimer CTGGCATAACAGATAG -[3890752:3890767] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) rhlR (PA3477) , rhlA (PA3479) , rhlB (PA3478)
      ... ... rhlR rhlA rhlB
      421 19682264
      NC_002516.2 P25084 dimer TGAGCAGTTCAGATAG +[4373862:4373877] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) PA3908 , PA3907 , PA3906 , PA3905 , PA3904 , prfC (PA3903)
      ... ... PA3908 PA3907 PA3906 PA3905 PA3904 prfC
      421 19682264
      NC_002516.2 P25084 dimer CTGGCAGAACTGACAG +[1349078:1349093] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) PA1245 , aprD (PA1246) , aprE (PA1247) , aprF (PA1248) , PA1244
      ... ... PA1245 aprD aprE aprF PA1244
      421 19682264
      NC_002516.2 P25084 dimer CTACCCACCCTGTTCG -[2088307:2088322] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) PA1914 , PA1913 , femI (PA1912) , femR (PA1911) , PA1915 , PA1916 , PA1917 , PA1918
      ... ... PA1914 PA1913 femI femR PA1915 PA1916 PA1917 PA1918
      421 19682264
      NC_002516.2 P25084 dimer CACCCTGTTCGTATCT -[2088302:2088317] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) PA1914 , PA1913 , femI (PA1912) , femR (PA1911) , PA1915 , PA1916 , PA1917 , PA1918
      ... ... PA1914 PA1913 femI femR PA1915 PA1916 PA1917 PA1918
      421 19682264
      NC_002516.2 P25084 dimer CTCGATCTTCTGATAG -[2928028:2928043] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) pqsH (PA2587) , PA2588 , PA2589 , PA2590 , PA2591
      ... ... pqsH PA2588 PA2589 PA2590 PA2591
      421 19682264
      NC_002516.2 P25084 dimer TTTTCAGTTGGACTCG +[1257584:1257599] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) PA1159 , PA1158 , PA1160 , rrmA (PA1161) , dapE (PA1162) , ndvB (PA1163)
      ... ... PA1159 PA1158 PA1160 rrmA dapE ndvB
      421 19682264
      NC_002516.2 P25084 dimer TAGCGAAAACATATCG +[1257514:1257529] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) PA1159 , PA1158 , PA1160 , rrmA (PA1161) , dapE (PA1162) , ndvB (PA1163)
      ... ... PA1159 PA1158 PA1160 rrmA dapE ndvB
      421 19682264
      NC_002516.2 P25084 dimer CCATCTGACATGTAGG +[27576:27591] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) plcB (PA0026) , PA0027 , PA0028 , aroE (PA0025) , hemF (PA0024) , PA0029 , PA0030 , betC (PA0031) , PA0032
      ... ... plcB PA0027 PA0028 aroE hemF PA0029 PA0030 betC PA0032
      422 19682264
      NC_002516.2 P25084 dimer CCTGGAGACCAGGCTG +[4604596:4604611] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) bphP (PA4117) , bphO (PA4116) , PA4115 , PA4118 , aph (PA4119) , PA4120
      ... ... bphP bphO PA4115 PA4118 aph PA4120
      422 19682264
      NC_002516.2 P25084 dimer CAATCAGAAATGTCCC +[5836795:5836810] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) PA5184 , PA5183 , PA5182 , PA5181.1 , PA5181 , PA5180 , PA5179 , PA5185 , PA5186 , PA5187 , PA5188 , PA5189 , PA5190
      ... ... PA5184 PA5183 PA5182 PA5181.1 PA5181 PA5180 PA5179 PA5185 PA5186 PA5187 PA5188 PA5189 PA5190
      422 19682264
      NC_002516.2 P25084 dimer CTAACAAAAGACATAG -[1087613:1087628] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) mvfR (PA1003) , phnB (PA1002) , phnA (PA1001) , pqsE (PA1000) , pqsD (PA0999) , pqsC (PA0998) , pqsB (PA0997) , pqsA (PA0996) , nadA (PA1004) , PA1005
      ... ... mvfR phnB phnA pqsE pqsD pqsC pqsB pqsA nadA PA1005
      422 19682264
      NC_002516.2 P25084 dimer CCGTCAGTATTGTTAG +[3483484:3483499] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) xcpP (PA3104) , xcpQ (PA3105) , xcpR (PA3103) , xcpS (PA3102) , xcpT (PA3101) , xcpU (PA3100) , xcpV (PA3099) , xcpW (PA3098) , xcpX (PA3097) , xcpY (PA3096) , xcpZ (PA3095) , PA3094.3 , PA3094.2 , PA3094.1 , PA3106 , metZ (PA3107) , purF (PA3108)
      ... ... xcpP xcpQ xcpR xcpS xcpT xcpU xcpV xcpW xcpX xcpY xcpZ PA3094.3 PA3094.2 PA3094.1 PA3106 metZ purF
      422 19682264
      NC_002516.2 P25084 dimer CTGTGAAATCTGGCAG -[3893270:3893285] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) rhlA (PA3479) , rhlB (PA3478) , rhlR (PA3477) , PA3480 , PA3481 , metG (PA3482) , PA3483 , PA3484 , PA3485
      ... ... rhlA rhlB rhlR PA3480 PA3481 metG PA3483 PA3484 PA3485
      422 19682264
      NC_002516.2 P25084 dimer CTACCAGATCTGGCAG +[141753:141768] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) PA0122 , PA0121 , PA0120 , PA0119 , PA0123
      ... ... PA0122 PA0121 PA0120 PA0119 PA0123
      422 19682264
      NC_002516.2 P25084 dimer CTGTCGGTTCGCATAG +[163289:163304] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) nuh (PA0143) , PA0142 , PA0144 , PA0145
      ... ... nuh PA0142 PA0144 PA0145
      422 19682264
      NC_002516.2 P25084 dimer CTGCCCATAATCCCCG -[165120:165135] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) PA0144 , nuh (PA0143) , PA0142 , PA0145
      ... ... PA0144 nuh PA0142 PA0145
      422 19682264
      NC_002516.2 P25084 dimer CTATCAGTTCTGTAGT -[935325:935340] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) PA0855 , fumC2 (PA0854) , PA0853 , PA0856 , bolA (PA0857)
      ... ... PA0855 fumC2 PA0853 PA0856 bolA
      422 19682264
      NC_002516.2 P25084 dimer CTGTGAGATTTGGGAG +[1078072:1078087] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) pqsA (PA0996) , pqsB (PA0997) , pqsC (PA0998) , pqsD (PA0999) , pqsE (PA1000) , ogt (PA0995) , cupC3 (PA0994) , cupC2 (PA0993) , cupC1 (PA0992) , phnA (PA1001) , phnB (PA1002) , mvfR (PA1003)
      ... ... pqsA pqsB pqsC pqsD pqsE ogt cupC3 cupC2 cupC1 phnA phnB mvfR
      422 19682264
      NC_002516.2 P25084 dimer CTACCTGTTTTGGTAG +[1803324:1803339] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) PA1656 , PA1657 , PA1658 , PA1659 , PA1655 , PA1654 , PA1653 , PA1652
      ... ... PA1656 PA1657 PA1658 PA1659 PA1655 PA1654 PA1653 PA1652
      422 19682264
      NC_002516.2 P25084 dimer CTATCAGAATGAATAG -[2291087:2291102] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) kynB (PA2081) , kynU (PA2080) , PA2082
      ... ... kynB kynU PA2082
      422 19682264
      NC_002516.2 P25084 dimer CTATCCATTCTGATGG +[2721746:2721761] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) pvdS (PA2426) , pvdG (PA2425) , pvdL (PA2424) , PA2427 , PA2428
      ... ... pvdS pvdG pvdL PA2427 PA2428
      422 19682264
      NC_002516.2 P25084 dimer CCGACAAATCTGTGAC +[3293937:3293952] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) PA2939 , PA2938 , PA2937 , PA2936 , PA2935 , cif (PA2934) , PA2933 , morB (PA2932) , cifR (PA2931) , PA2930 , PA2929 , PA2940 , PA2941 , PA2942 , PA2942.1
      ... ... PA2939 PA2938 PA2937 PA2936 PA2935 cif PA2933 morB cifR PA2930 PA2929 PA2940 PA2941 PA2942 PA2942.1
      422 19682264
      NC_002516.2 P25084 dimer CTGGCCGATGGGCGCG +[3954756:3954771] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) PA3535 , PA3534 , PA3533 , PA3532 , bfrB (PA3531)
      ... ... PA3535 PA3534 PA3533 PA3532 bfrB
      422 19682264
      NC_002516.2 P25084 dimer CTATGCGTCCGGACAG +[4830567:4830582] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) flp (PA4306) , rcpC (PA4305) , rcpA (PA4304) , tadZ (PA4303) , tadA (PA4302) , tadB (PA4301) , tadC (PA4300) , tadD (PA4299) , PA4298 , tadG (PA4297) , pprB (PA4296) , fppA (PA4295) , PA4294 , pprA (PA4293) , PA4292 , PA4291 , PA4290 , PA4289 , PA4288 , PA4287 , PA4286 , recC (PA4285) , recB (PA4284) , recD (PA4283) , PA4282 , sbcD (PA4281)
      ... ... flp rcpC rcpA tadZ tadA tadB tadC tadD PA4298 tadG pprB fppA PA4294 pprA PA4292 PA4291 PA4290 PA4289 PA4288 PA4287 PA4286 recC recB recD PA4282 sbcD
      422 19682264
      NC_002516.2 P25084 dimer CTATCCGTTCTGTCCC -[5891086:5891101] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) PA5232 , PA5231 , PA5230 , PA5229 , PA5233
      ... ... PA5232 PA5231 PA5230 PA5229 PA5233
      422 19682264
      NC_002516.2 P25084 dimer GTACCTGAACTGCCAG -[883349:883364] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) PA0805 , PA0806
      ... ... PA0805 PA0806
      422 19682264
      NC_002516.2 P25084 dimer CTATCTGAAATGCGAG -[3791169:3791184] Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) phnC (PA3384) , amrZ (PA3385) , PA3383 , phnE (PA3382) , PA3381 , PA3380 , PA3379 , PA3378 , PA3377 , PA3376 , PA3375 , PA3374 , PA3373 , PA3372 , PA3371 , PA3370 , PA3369
      ... ... phnC amrZ PA3383 phnE PA3381 PA3380 PA3379 PA3378 PA3377 PA3376 PA3375 PA3374 PA3373 PA3372 PA3371 PA3370 PA3369
      422 19682264
      NC_002516.2 P25084 dimer CTATCAATTGTATTAG -[2545013:2545028] Experimental technique details ChIP-PCR (ECO:0005620) ambB (PA2305) , ambC (PA2304) , ambD (PA2303) , ambE (PA2302) , PA2301 , ambA (PA2306) , PA2307 , PA2308 , PA2309 , PA2310
      ... ... ambB ambC ambD ambE PA2301 ambA PA2307 PA2308 PA2309 PA2310
      423 19682264
      NC_002516.2 P25084 dimer CTAGCAAATGAGATAG -[1559180:1559195] Experimental technique details ChIP-PCR (ECO:0005620) rsaL (PA1431) , lasI (PA1432) , lasR (PA1430) , PA1433 , PA1434
      ... ... rsaL lasI lasR PA1433 PA1434
      423 19682264
      NC_002516.2 P25084 dimer CCATCTGACATGTAGG +[27576:27591] Experimental technique details ChIP-PCR (ECO:0005620) plcB (PA0026) , PA0027 , PA0028 , aroE (PA0025) , hemF (PA0024) , PA0029 , PA0030 , betC (PA0031) , PA0032
      ... ... plcB PA0027 PA0028 aroE hemF PA0029 PA0030 betC PA0032
      423 19682264
      NC_002516.2 P25084 dimer CCTGGAGACCAGGCTG +[4604596:4604611] Experimental technique details ChIP-PCR (ECO:0005620) bphP (PA4117) , bphO (PA4116) , PA4115 , PA4118 , aph (PA4119) , PA4120
      ... ... bphP bphO PA4115 PA4118 aph PA4120
      423 19682264
      NC_002516.2 P25084 dimer CAATCAGAAATGTCCC +[5836795:5836810] Experimental technique details ChIP-PCR (ECO:0005620) PA5184 , PA5183 , PA5182 , PA5181.1 , PA5181 , PA5180 , PA5179 , PA5185 , PA5186 , PA5187 , PA5188 , PA5189 , PA5190
      ... ... PA5184 PA5183 PA5182 PA5181.1 PA5181 PA5180 PA5179 PA5185 PA5186 PA5187 PA5188 PA5189 PA5190
      423 19682264
      NC_002516.2 P25084 dimer GCGTCAGATTTCCTCG +[2453397:2453412] Experimental technique details Beta-gal reporter assay pslA (PA2231) , pslB (PA2232) , pslC (PA2233) , pslD (PA2234) , pslE (PA2235) , pslF (PA2236) , pslG (PA2237) , pslH (PA2238) , pslI (PA2239) , pslJ (PA2240) , pslK (PA2241) , pslL (PA2242) , PA2230 , PA2229
      ... ... pslA pslB pslC pslD pslE pslF pslG pslH pslI pslJ pslK pslL PA2230 PA2229
      424 19682264
      NC_002516.2 P25084 dimer CTAAGATAGCTATCAC +[2453504:2453519] Experimental technique details Beta-gal reporter assay pslA (PA2231) , pslB (PA2232) , pslC (PA2233) , pslD (PA2234) , pslE (PA2235) , pslF (PA2236) , pslG (PA2237) , pslH (PA2238) , pslI (PA2239) , pslJ (PA2240) , pslK (PA2241) , pslL (PA2242) , PA2230 , PA2229
      ... ... pslA pslB pslC pslD pslE pslF pslG pslH pslI pslJ pslK pslL PA2230 PA2229
      424 19682264
      NC_002516.2 P25084 dimer TTTTCAGTTGGACTCG +[1257584:1257599] Experimental technique details Beta-gal reporter assay PA1159 , PA1158 , PA1160 , rrmA (PA1161) , dapE (PA1162) , ndvB (PA1163)
      ... ... PA1159 PA1158 PA1160 rrmA dapE ndvB
      424 19682264
      NC_002516.2 P25084 dimer TAGCGAAAACATATCG +[1257514:1257529] Experimental technique details Beta-gal reporter assay PA1159 , PA1158 , PA1160 , rrmA (PA1161) , dapE (PA1162) , ndvB (PA1163)
      ... ... PA1159 PA1158 PA1160 rrmA dapE ndvB
      424 19682264
      NC_002516.2 P25084 dimer TAACTAGCAAATGAGATAGATT -[1559177:1559198] Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) rsaL (PA1431) , lasR (PA1430) , lasI (PA1432) , PA1433 , PA1434
      ... ... rsaL lasR lasI PA1433 PA1434
      425 18045385
      NC_002516.2 P25084 not specified TCACATATCTGATAGCCTG +[5366181:5366199] Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) cueR (PA4778) , pmrB (PA4777)
      ... ... cueR pmrB
      576 20233934
      NC_002516.2 P25084 not specified ACCTACCAGAACTGGTAGTT -[2934482:2934501] Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) PA2591 , PA2590 , PA2589 , PA2592
      ... ... PA2591 PA2590 PA2589 PA2592
      578 17449616
      NC_002516.2 P25084 not specified ACCTGCCCGGAAGGGCAGGT -[2068995:2069014] Experimental technique details Beta-gal reporter assay - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) qscR (PA1898) , PA1897 , PA1896 , PA1895 , PA1894 , PA1893 , PA1892 , PA1891 , PA1890
      ... ... qscR PA1897 PA1896 PA1895 PA1894 PA1893 PA1892 PA1891 PA1890
      653 11544214
      NC_002516.2 P25084 not specified CACTGCCAGATCTGGCAGTT +[2031376:2031395] Experimental technique details Beta-gal reporter assay - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) PA1869
      ... ... PA1869
      653 11544214
      NC_002516.2 P25084 not specified ACCTACCAGATCTTGTAGTT +[4713405:4713424] Experimental technique details Beta-gal reporter assay - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) phzA1 (PA4210) , phzM (PA4209) , phzB1 (PA4211) , phzC1 (PA4212) , phzD1 (PA4213) , phzE1 (PA4214) , phzF1 (PA4215) , phzG1 (PA4216)
      ... ... phzA1 phzM phzB1 phzC1 phzD1 phzE1 phzF1 phzG1
      653 11544214
      NC_002516.2 P25084 not specified ACCTGCCAGTTCTGGCAGGT -[4170656:4170675] Experimental technique details Beta-gal reporter assay - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) lasB (PA3724)
      ... ... lasB
      766 8576049
      NC_002516.2 P25084 not specified ACCTGCTTTTCTGCTAGCT -[4170717:4170735] Experimental technique details Beta-gal reporter assay - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) lasB (PA3724)
      ... ... lasB
      766 8576049
      NC_002516.2 P25084 not specified CCCTACCAGATCTGGCAGG -[3889880:3889898] Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Primer Extension assay (ECO:0005657) rhlI (PA3476)
      ... ... rhlI
      767 12076794

      LasR - UniProtKB: P54292 regulon and binding site collection of Pseudomonas aeruginosa UCBPP-PA14


      Sites are listed as curated.

      CTGTGAGATCTGGGAG

      Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

      CTGTGAGATCTGGGAG

      For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

        Genome TF TF conformation Site sequence Site location Experimental techniques Gene regulation Curations PMIDs
        NC_008463.1 P54292 not specified CTGTGAGATCTGGGAG -[4571843:4571858] Experimental technique details Beta-gal reporter assay - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) pqsA (PA14_51430) , pqsB (PA14_51420) , pqsC (PA14_51410) , pqsD (PA14_51390) , pqsE (PA14_51380) , phnA (PA14_51360) , phnB (PA14_51350) , mvfR (PA14_51340) , ogt (PA14_51440) , cupC3 (PA14_51450) , cupC2 (PA14_51460) , cupC1 (PA14_51470)
        ... ... pqsA pqsB pqsC pqsD pqsE phnA phnB mvfR ogt cupC3 cupC2 cupC1
        417 16735731

        LasR - UniProtKB: P25084 regulon and binding site collection of Pseudomonas aeruginosa UCBPP-PA14


        Sites are listed as curated.

        CTAACAAAAGACATAG

        Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

        CTAACAAAAGACATAG